Authors

DOI:

https://doi.org/10.37547/ajast/Volume05Issue06-21

Keywords:

Transgenic mouse Cathepsin D Mitochondrial bioenergetics

Abstract

A study investigating the role of cathepsin D (CTSD) in neuroprotection has provided compelling evidence of its critical importance in preventing neurodegenerative processes.

The central idea of the work is that overexpression of CTSD can compensate for the deficiency of this enzyme caused by genetic knockout, thereby preventing the development of lethal consequences and the accumulation of amyloid plaques characteristic of neurodegenerative diseases such as Alzheimer's disease.

Lysosomes, intracellular organelles, play a key role in the degradation of proteins and other cellular components, thereby ensuring cellular homeostasis. Cathepsins, including CTSD, are the most important lysosomal proteases responsible for the breakdown of various substrates, including toxic protein aggregates. CTSD deficiency in humans leads to the development of neurolipofuscinosis (NCL), a group of severe inherited neurodegenerative diseases characterized by the accumulation of lipofuscin in nerve cells and progressive neuronal damage. This disease demonstrates a direct link between lysosomal protease deficiency and the development of neurodegeneration.


background image

American Journal of Applied Science and Technology

92

https://theusajournals.com/index.php/ajast

VOLUME

Vol.05 Issue 06 2025

PAGE NO.

92-96

DOI

10.37547/ajast/Volume05Issue06-21



Transgenic Mice Have Proven Successful in Combating
Neurogenerative Diseases

Sultonova Dildor Bakhshilloyevna

Assistant, Department of Biochemistry of the Bukhara State Medical Institute named after Abu Ali Ibn Sino, Uzbekistan

Received:

23 April 2025;

Accepted:

19 May 2025;

Published:

21 June 2025

Abstract:

A study investigating the role of cathepsin D (CTSD) in neuroprotection has provided compelling evidence

of its critical importance in preventing neurodegenerative processes.
The central idea of the work is that overexpression of CTSD can compensate for the deficiency of this enzyme caused
by genetic knockout, thereby preventing the development of lethal consequences and the accumulation of amyloid
plaques characteristic of neurodegenerative diseases such as Alzheimer's disease.
Lysosomes, intracellular organelles, play a key role in the degradation of proteins and other cellular components,
thereby ensuring cellular homeostasis. Cathepsins, including CTSD, are the most important lysosomal proteases
responsible for the breakdown of various substrates, including toxic protein aggregates. CTSD deficiency in humans
leads to the development of neurolipofuscinosis (NCL), a group of severe inherited neurodegenerative diseases
characterized by the accumulation of lipofuscin in nerve cells and progressive neuronal damage. This disease
demonstrates a direct link between lysosomal protease deficiency and the development of neurodegeneration.

Keywords:

Transgenic mouse, Cathepsin D, Mitochondrial bioenergetics, Apoptosis, Cathepsin D knockout mice,

Dopamine, Autophagy, Lysosome, Life expectancy, Behavior, Neuronal, ceroid, lipofuscinosis.

Introduction: Preface

Previous studies using a CTSD gene knockout mouse
model (CtsdKO or CDKO) have confirmed this
association. CDKO mice showed intracellular
accumulation of protein aggregates, decreased
proteasome activity (another critical protein
degradation system), and, importantly, early
postnatal lethality at around day 26 of life. These
findings highlight the critical role of CTSD in
maintaining cellular health and preventing the
accumulation of potentially toxic proteins.

To study the protective properties of CTSD, the
researchers developed a new transgenic mouse strain
that overexpressed human CTSD specifically in cells of
the nervous system. This was achieved by using the
Cre-loxP recombination system, which allowed CTSD
gene expression to be activated only in cells
expressing the Nestin protein, a marker of neural
stem cells and neurons. Thus, CTSD was
overexpressed selectively in neural tissue, eliminating
the potential side effects of systemic overproduction

of the enzyme. These mice, designated CDtg,
demonstrated normal behavior and sensitivity to
neurotoxic agents such as MPTP (1-methyl-4-phenyl-
1,2,3,6-tetrahydropyridine), indicating that CTSD
overexpression does not have significant negative
consequences.

On the experiment that plays a decisive role in the
study

: The key experiment involved crossing CDtg

mice with CDKO mice. The results were dramatic:
overexpression of CTSD in the nervous system of
CDKO mice significantly extended their lifespan,
partially restored the reduced proteasome activity,
and, most importantly, reduced the accumulation of

Aβ42, an amyloid peptide that plays a key role in the

development of Alzheimer's disease. Thus, the
experimental data confirm the protective role of
CTSD against proteotoxicity and the accumulation of
toxic protein aggregates. Importantly, overexpression
of other cathepsins (B and L) did not show a similar
effect, confirming the specificity of the role of CTSD.


background image

American Journal of Applied Science and Technology

93

https://theusajournals.com/index.php/ajast

American Journal of Applied Science and Technology (ISSN: 2771-2745)

In conclusion, the study demonstrated the potential
of CTSD enhancement strategy as a therapeutic
approach to combat neurodegenerative diseases. The
developed transgenic mouse line represents a
valuable model for further research in this area,
allowing to study the mechanisms of CTSD-mediated
neuroprotection and to develop new treatment
strategies. Moreover, the results of the study confirm
the

importance

of

maintaining

lysosomal

homeostasis to prevent neurodegenerative processes
and open new avenues for the development of
therapeutic strategies aimed at enhancing lysosomal
protein degradation in the nervous system. This is of
great importance for the search for effective drugs to
combat

Alzheimer's

disease

and

other

neurodegenerative diseases for which there is
currently no effective treatment.

Introduction

Lysosomes are intracellular organelles that perform a
vital function of recycling cellular components. They
act as recycling centers, breaking down damaged
proteins, organelles, and other cellular waste through
a process called autophagy. This process is critical for
maintaining the health and normal functioning of
cells. Dysfunction of the autophagic system is closely
associated

with

the

development

of

neurodegenerative diseases such as Parkinson's
disease (PD) and Alzheimer's disease (AD). Many
genes that are mutated in PD are involved in or affect
the normal functioning of the autophago-lysosomal
pathway. Insufficient efficiency of this pathway
contributes to the accumulation of amyloid plaques
and tau proteins, the hallmarks of AD. Cathepsin D
(CTSD), an aspartate protease activated in the acidic
environment of lysosomes, plays a central role in
lysosomal degradation. Its key function is supported
by the fact that genetic deficiency of CTSD causes
neuronal ceroid lipofuscinosis (NCL), a severe
neurodegenerative disease, in humans. Patients with
NCL, which is caused by a mutation in the CTSD gene,
exhibit profound motor impairment. Even decreased
CTSD levels in neurons of the substantia nigra, a brain
region critical for motor function, are observed in

Parkinson’s disease, implicating it in the pathogenesis
of this disease. The association between Parkinson’s
disease and the accumulation of α

-synuclein, a

protein that forms aggregates in neurons in this
disease, is closely linked to lysosomal dysfunction.
Lysosome dysfunction, specifically decreased CTSD

activity, prevents the efficient degradation of α

-

synuclein, leading to its accumulation and, ultimately,
neuronal death. This underscores the critical role of
lysosomes and CTSD in maintaining the health of the
nervous system.

METHODS

Mice

: To study the role of CTSD in neurodegenerative

processes, genetically modified Ctsd knockout (CDKO)
mice are used. These mice, lacking a functional CTSD
gene, display severe pathological changes. They
exhibit neuronal, inflammatory and systemic
abnormalities and, most importantly, have a
significantly reduced lifespan, dying at approximately
26 days of age due to intestinal necrosis. This
confirms the vital role of CTSD in maintaining the
div's homeostasis. A more detailed study of CDKO
mice showed the accumulation of autophagosomes ,

structures involved in autophagy, as well as α

-

synuclein. This clearly demonstrates that the absence
of CTSD disrupts the autophago-lysosomal pathway,
leading to the accumulation of proteins that would
normally be disposed of. In addition, CDKO mice were

found to accumulate insoluble Aβ42, a peptide that is

a key component of amyloid plaques in Alzheimer's
disease. This suggests that CTSD dysfunction may be
involved

in

the

pathogenesis

of

various

neurodegenerative diseases. Thus, the study of
transgenic mice with cathepsin D gene knockout
provides convincing evidence of the important role of
this lysosomal enzyme in maintaining cellular
homeostasis and preventing the development of
neurodegenerative diseases. Disruption of its
function leads to impaired autophagy, accumulation
of toxic proteins and, as a consequence, severe
pathological changes, which makes CTSD a promising
target for the development of new therapeutic
strategies in the fight against Parkinson's disease,
Alzheimer's disease and other neurodegenerative
diseases. Further research in this direction can lead to
the creation of new methods of treatment and
prevention of these severe diseases, significantly
improving the quality of life of patients. In particular,
the study of mitochondrial bioenergetics in the
context of CTSD deficiency may provide additional
clues to understanding the mechanisms of
neurodegenerative

processes

and

developing

targeted therapeutic approaches aimed at improving
cellular metabolism and preventing neuronal
apoptosis. Deep understanding of the relationship
between CTSD function, autophagy, accumulation of
toxic proteins and changes in mitochondria
represents a huge potential for developing effective
treatment strategies for neurodegenerative diseases.
It is important to take into account the complex
nature of these diseases and develop therapeutic
approaches aimed at correcting several interrelated
pathological mechanisms.

Chemicals

: Sigma

Aldrich supplied chloroquine (CQ)

(C-6628-25G), MPTP (M0896-10 MG), 1-methyl-4-


background image

American Journal of Applied Science and Technology

94

https://theusajournals.com/index.php/ajast

American Journal of Applied Science and Technology (ISSN: 2771-2745)

phenylpyridinium (MPP+) (D048-100 MG), and
staurosporine (S4400-0.5 MG). Soligomycin, FCCP,
and antimycin were purchased from Agilent
/Seahorse Bioscience.

Neuronal cultures

: Primary neuronal culture Neurons

of the cerebral cortex were isolated from mouse
embryos at the age of 24, 25 and 26 days. For this
purpose, mouse brain was dissected in ice-cold
Hanks' solutions lacking Ca2+ and Mg2+. For this
purpose, mouse brain was dissected in ice-cold
Hanks' solutions lacking Ca2+. The cerebral cortex
was incubated for 15 min at 37 °C with the addition of
papain (Worthington). After tissue mincing, the cells
were isolated by centrifugation at 25 °C for 5 min at
1000 × g. The cells were then resuspended in
Neurobasal medium containing 2% B27 supplement
(Invitrogen 17504-044), 1% Pen-Strep (at a
concentration of 10,000 units/mL) and placed in 24-
or 6-well plates pre-coated with poly-L-lysine
(concentration of 0.1 mg/mL). plate. The plates with
cultures were kept in a humidified incubator at 37° C.
For Immunocytochemical analysis of these cultures
used NeuN and GFAP antibodies and found that
cultures aged DIV7-14 contained more than 80%
neurons.

Measuring mitochondrial function:

Mitochondrial

function in mouse primary cortical neurons was
measured using a Seahorse Bioscience XF24
Extracellular Flux Analyzer24,27,28,29,30,31,32,33.
Cells were seeded at 80,000 cells per well, and the
concentrations of oligomycin , FCCP, and antimycin A

were used at 1 μg/mL, 1 μmol/L, and 10 μmol/L,

respectively. Following measurements, total protein
in each well was determined using a DC protein assay
(Bio- Rad ), and the oxygen consumption rate (OCR
pmo

l / min ) was normalized to μg protein in each

well.

Proteasome activity assays:

We used 40 μg of cortical

extracts (in triplicate and with n = 3 mice each) and 50

μmol/L substrate in an assay buffer consisting of 50

mmol/L Tris ( pH 7.5), 2.5 mmol/L EGTA, 20% glycerol,
1 mmol/L DTT, 0.05% NP -40. Fluorescence was
measured at an excitation wavelength of 380 nm and
an emission wavelength of 460 nmol/L every 5 min for
2 h. 2.12. For the open-label test, the fluorescence
was measured at an excitation wavelength of 380 nm
and an emission wavelength of 460 nmol/L every 5
min for 2 h. fields 23,24 used Ethovision software to
conduct this test for 5 minutes for each mouse
individually.

Behavioural tests:

The mouse movements were

tracked, recording the total distance traveled (cm),
position within the field (time in the center compared

to the wall in seconds), and average speed (cm/s). For
Zero Maze (diameter 70 cm), which consists of two
parts with sides 15 cm high and two parts with a wall
0.5 cm, which were placed in the arena and tracked
by an Ethovision camera for 4 minutes. Each mouse
was placed in the arena and tracked by an Ethovision
camera for 4 minutes. Recordings were animal
position in the arena at 5 frames per second and time
spent in the open or closed arm. SDI grip force system
( San Diego Instruments ) was used to measure
hindlimb grip strength and limb strength in mice using
the Meyer method36. For the Tail test Flick used the
overhead halogen light source, providing thermal
stimulation of the 4 mm x 6 mm area for the tail. For
the experiment with the rotating rod 23,24 the
paradigm included three days of testing mice on a
rotating rod ( San Diego Instruments ), which
gradually accelerated from 4 to 40 revolutions per a
minute, and displays the reaction time in 0.01 s
increments. For the rotating test, rod 23,24 the
paradigm included 3 days. For every mouse every day
registered delay falls. For the Morris water maze
test23,24,37,38 a 120 cm diameter pool and a 10 cm
diameter platform positioned 0.5 cm below the water
surface were used. Four trials were conducted per
day on days 1

5, so that all starting positions were

used equally (in random order). Mice give 60 s to find
the platform and 10 s to stay on the platform. The
running wheel analysis was used with with help cells
with a running wheel ( Lafayette Instrument ). Mice
were housed individually in cages with a running
wheel, where they were provided with food and
water ad libitum .C using the Activity system software
Wheel Monitoring ( AWM ) were measured distances
during the day and nights.

Analysis of striatal monoamines by HPLC

: WITH using

a dedicated HPLC analysis with an Antec
electrochemical detector Decade II (oxidation 0.4) are
extracted and determined using a dedicated HPLC
analysis using an Antec electrochemical detector
Decade II (oxidation 0.4). The copy number of
mitochondrial DNA was determined by real-time PCR

using

the

forward

primer

5′

-

ccccagccataacacagtatcaaac -

3′ and the reverse primer

5′

- gcccaaagaatcagaacagatgc -

3′ in ABI 7500 (Appli

ed

Biosystems )25,39, 40, 41, 42. Real-time PCR
conditions were next 94° C for 2 min, then 40 cycles
of denaturation at 94° C for 15 s, annealing and
extension at 60° C for 1 min.

Quantification of mtDNA:

Mitochondrial DNA copy

number was normalized by real-time PCR of the 18 S

nuclear sequence using forward primer 5′

-

aaacggctaccacatccaag -

3′ and reverse primer 5′

-

caattacagggcctcgaaag -

3′.


background image

American Journal of Applied Science and Technology

95

https://theusajournals.com/index.php/ajast

American Journal of Applied Science and Technology (ISSN: 2771-2745)

TUNEL

Coloring

: CDKO, CDtg and CDtg mice at p23

25 was used for TUNEL staining (InvitrogenTM Click -
iTTM Plus Assay Kits TUNEL for detection of apoptosis
in situ, catalog C 10617), DNase-treated sections were
used as positive controls, TdT treatment was not was
used.

RESULTS

Investigation of the effects of CTSD overexpression
on cellular bioenergetics and mitochondrial function

Generation of transgenic mice with CTSD of the
nervous system (CDtg):CTSD transgenic mice
(CTSDfloxedstop ) have been created that are capable
of overexpressing CTSD in Cre -expressing tissues .
When crossed with Nestin - cre transgenic animals,
increased expression of CTSD mRNA is observed in
the double transgenic mice. animals. Shown wild-type
genomic structure, pCAG - loxp - STOP - loxp - hCTSD
insertion into the Hprt site, and genomic structure in
Nestin - cre expressing cells after crossing with Nestin
- cre mice . There are genotyping results of 4 offspring
of CTSDfloxedstop and Nestin - cre mice using PCR #
1 in the diagram, indicating that hCTSD is inserted into
the Hprt allele . PCR products #1 indicate that the
mice carry a CTSDfloxedstop knockout . PCR products
using primers corresponding to the cDNA Cre
recombinases indicate that the mouse carries the
Nestin - cre transgene . Therefore, lane 1 represents
a transgenic animal with CTSDfloxedstop and Nestin -
cre . After PCR with primers PCR#1 and cre, DNA is
extracted from 6 offspring with cre + and either +
PCR#1 results.

This work is devoted to the study of the effect of
increased CTSDa expression on cellular bioenergetics
and mitochondrial function. The authors used a
mouse model with transgenic overexpression of CTSD
and conducted a series of experiments to assess the
impact of this change on various aspects of cellular
function.

*CTSDa overexpression had no significant effect on
mitochondrial function measured by oxygen
consumption and ATP production.

* No changes in the expression of genes related to
autophagy, lysosomal pathways, or mitochondrial
biogenesis were detected, indicating that CTSDa does
not directly influence these processes.

* There were also no significant differences in
mitochondrial

DNA

levels

between

CTSDa-

overexpressing mice and controls.

The authors concluded that although CTSDa is a
lysosomal enzyme, its overexpression does not result
in significant changes in mitochondrial function or
biogenesis.

Additional notes

: The work contains a detailed

description of the methods used and statistical
analysis of the data.

discuss the limitations of their study and suggest
directions for future work.

This work represents a well-considered study that
contributes to our understanding of the role of CTSDa
in cellular processes.

Sources

:Xiaosen Ouyang , Willayat I. Wani, Gloria A.

Benavides , Matthew J. Redman , and Hy Vo
performed the experiments. Thomas van Groen .
Victor Darley-Usmar and Jianhua Zhang . Xiaosen
Ouyang And Jianhua Zhang Acrobat PDF (2 MB ) -
Cathepsin D overexpression in the nervous system

rescues lethality and A β 42 accumulation of

cathepsin D systemic knockout in vivo- Acta
Pharmaceutica Sinica B Volume 13, Issue 10, October
2023, Pages 4172-4184

REFERENCES

Z. Gan-Or, PA Dion, GA Rouleau

Genetic Perspective on the Role of the Autophagy -
Lysosome Pathway in Parkinson's Disease Autophagy
, 11 (2015), pp. 1443-1457 View at publisher

CrossrefView in ScopusGoogle Scholar

J. Zhang , M. L. Culp , J. G. Craver , V. Darley - Usmar
Mitochondrial function and autophagy : integration
of proteotoxic , redox , and metabolic stress in
Parkinson's disease J Neurochem , 144 ( 2018 ), pp .
691

709 View at publisher CrossrefView at

ScopusGoogle Scholar

3 . D . J . Colacurcio , A . Pensalfini , Y . Jiang , R . A .
Nixon Dysfunction of autophagy and endosomal -
lysosomal pathways: role in the pathogenesis of
Down syndrome and Alzheimer's disease Free Radical
Biol Med , 114 (2018), pp. 40-51 View PDF View
ArticleView in ScopusGoogle Scholar

RA Nixon The role of autophagy in neurodegenerative
diseases Nat Med , 19 (2013), pp. 983

997 View at

publisher Crossref View at ScopusGoogle Scholar

L. Schneider , J. Zhang Lysosomal function in
macromolecular homeostasis and bioenergetics in
Parkinson 's disease Mol Neurodegener , 5 (2010), p.
14 View at publisher CrossrefView at ScopusGoogle
Scholar

E. Siintola , S. Partanen, P. Stromme , A. Haapanen ,
M. Haltia , J. Maehlen And etc.

Cathepsin D deficiency underlies human congenital
neuronal ceroid lipofuscinosis Brain , 129 (2006), pp.
1438

1445 View at publisher CrossrefView at

ScopusGoogle Scholar


background image

American Journal of Applied Science and Technology

96

https://theusajournals.com/index.php/ajast

American Journal of Applied Science and Technology (ISSN: 2771-2745)

R. Steinfeld, K. Reinhardt, K. Schreiber, M. Hillebrand,
R. Kraetzner , W. Bruck and dr . Cathepsin D deficiency
linked to human neurodegenerative disorder Am J
Hum Genet , 78 (2006), pp. 988

998 View PDF View

ArticleCrossrefView in ScopusGoogle Scholar

Y. D. H. Chu , P. Aebischer , C. W. Olanow , J. H.
Kordower Alterations in lysosomal and proteasomal
markers in Parkinson 's disease : association with
alpha - synuclein inclusions Neurobiol Dis , 35 (2009),
pp. 385-398 View PDF View ArticleView in
ScopusGoogle Scholar

B. Dehay , J. Bove, N. Rodriguez- Muela , C. Perier , A.
Recasens , P. Boya and etc.

Pathogenic lysosomal depletion in Parkinson's
disease J Neurosci , 30 (2010), pp. 12535

12544 View

in ScopusGoogle Scholar

W. Peng , G. Minakaki , M. Nguyen , D. Krainc
Preservation of lysosomal function in the aging brain:
insights from neurodegeneration Neurotherapeutics ,
16 (2019 ) , pp . 611

634 View PDF View

articleCrossrefView in ScopusGoogle Scholar

M. Usenovic , E. Tresse , J. R. Mazzulli , J. P. Taylor , D.
Krainc ATP13A2 deficiency results in lysosomal
dysfunction, alpha - synuclein accumulation , and
neurotoxicity J Neurosci , 32 (2012), pp. 4240

4246

View at ScopusGoogle Scholar

P. Saftig , M. Hetman, W. Schmahl , K. Weber, L.
Heine, H. Mossmann And etc.

Mice deficient in the lysosomal proteinase cathepsin
D exhibit progressive atrophy of the intestinal mucosa
and profound destruction of lymphoid cells EMBO J,
14

(1995),

pp.

3599

3608

View

at

publisherCrossrefView at ScopusGoogle Scholar

H. Nakanishi, J. Zhang, M. Koike, T. Nishioku , Y.

Okamoto, E. Kominami And dr . Involvement of nitric
oxide released from microglia -macrophages in
pathological changes in cathepsin-deficient mice DJ
Neurosci , 21 (2001), pp. 7526

7533 View at

publisherCrossrefView at ScopusGoogle Scholar

M. Koike, M. Shibata, S. Waguri , K. Yoshimura, I.
Tanida, E. Kominami And etc.

Involvement of autophagy in lysosome storage in
neurons from mouse models of neuronal ceroid
lipofuscinosis ( Batten disease ) Am J Pathol , 167
(2005), pp. 1713

1728 View PDF View Article View in

ScopusGoogle Scholar

L. Qiao , S. Hamamichi , K. A. Caldwell, G. A. Caldwell,
T. A. Yacoubian, S. Wilson and dr . Lysosomal enzyme
cathepsin D protects against alpha-synuclein
aggregation and toxicity Mol Brain, 1 (2008), p. 17
View in ScopusGoogle Scholar

V. Cullen, M. Lindfors , J. Ng, A. Paetau , E. Swinton, P.
Kolodziej And etc. Cathepsin D expression level
influences alpha-synuclein processing, aggregation
and toxicity in vivo Mol Brain , 2 (2009), p. 5 View in
ScopusGoogle Scholar

C. N. Suire , S. O. Abdul - Hay , T. Sahara , D. Kang , M.
K. Brizuela , P. Saftig , et al. Cathepsin D regulates
cerebral Abeta42 / 40 ratios through differential
degradation of Abeta42 and Abeta40 in Alzheimer 's
disease Res Ther , 12 (2020), p. 80 View in
ScopusGoogle Scholar

18.C. N. Suire , M. A. Leissring Cathepsin D: A Potential
Link Between Amyloid Beta Protein and Tauopathy in
Alzheimer's Disease J Exp Neurol , 2 (2021), pp. 10-15
Google Scholar

References

Z. Gan-Or, PA Dion, GA Rouleau

Genetic Perspective on the Role of the Autophagy -Lysosome Pathway in Parkinson's Disease Autophagy , 11 (2015), pp. 1443-1457 View at publisher

CrossrefView in ScopusGoogle Scholar

J. Zhang , M. L. Culp , J. G. Craver , V. Darley - Usmar Mitochondrial function and autophagy : integration of proteotoxic , redox , and metabolic stress in Parkinson's disease J Neurochem , 144 ( 2018 ), pp . 691–709 View at publisher CrossrefView at ScopusGoogle Scholar

D . J . Colacurcio , A . Pensalfini , Y . Jiang , R . A . Nixon Dysfunction of autophagy and endosomal -lysosomal pathways: role in the pathogenesis of Down syndrome and Alzheimer's disease Free Radical Biol Med , 114 (2018), pp. 40-51 View PDF View ArticleView in ScopusGoogle Scholar

RA Nixon The role of autophagy in neurodegenerative diseases Nat Med , 19 (2013), pp. 983–997 View at publisher Crossref View at ScopusGoogle Scholar

L. Schneider , J. Zhang Lysosomal function in macromolecular homeostasis and bioenergetics in Parkinson 's disease Mol Neurodegener , 5 (2010), p. 14 View at publisher CrossrefView at ScopusGoogle Scholar

E. Siintola , S. Partanen, P. Stromme , A. Haapanen , M. Haltia , J. Maehlen And etc.

Cathepsin D deficiency underlies human congenital neuronal ceroid lipofuscinosis Brain , 129 (2006), pp. 1438–1445 View at publisher CrossrefView at ScopusGoogle Scholar

R. Steinfeld, K. Reinhardt, K. Schreiber, M. Hillebrand, R. Kraetzner , W. Bruck and dr . Cathepsin D deficiency linked to human neurodegenerative disorder Am J Hum Genet , 78 (2006), pp. 988–998 View PDF View ArticleCrossrefView in ScopusGoogle Scholar

Y. D. H. Chu , P. Aebischer , C. W. Olanow , J. H. Kordower Alterations in lysosomal and proteasomal markers in Parkinson 's disease : association with alpha - synuclein inclusions Neurobiol Dis , 35 (2009), pp. 385-398 View PDF View ArticleView in ScopusGoogle Scholar

B. Dehay , J. Bove, N. Rodriguez- Muela , C. Perier , A. Recasens , P. Boya and etc.

Pathogenic lysosomal depletion in Parkinson's disease J Neurosci , 30 (2010), pp. 12535–12544 View in ScopusGoogle Scholar

W. Peng , G. Minakaki , M. Nguyen , D. Krainc Preservation of lysosomal function in the aging brain: insights from neurodegeneration Neurotherapeutics , 16 (2019 ) , pp . 611–634 View PDF View articleCrossrefView in ScopusGoogle Scholar

M. Usenovic , E. Tresse , J. R. Mazzulli , J. P. Taylor , D. Krainc ATP13A2 deficiency results in lysosomal dysfunction, alpha - synuclein accumulation , and neurotoxicity J Neurosci , 32 (2012), pp. 4240–4246 View at ScopusGoogle Scholar

P. Saftig , M. Hetman, W. Schmahl , K. Weber, L. Heine, H. Mossmann And etc.

Mice deficient in the lysosomal proteinase cathepsin D exhibit progressive atrophy of the intestinal mucosa and profound destruction of lymphoid cells EMBO J, 14 (1995), pp. 3599–3608 View at publisherCrossrefView at ScopusGoogle Scholar

H. Nakanishi, J. Zhang, M. Koike, T. Nishioku , Y. Okamoto, E. Kominami And dr . Involvement of nitric oxide released from microglia -macrophages in pathological changes in cathepsin-deficient mice DJ Neurosci , 21 (2001), pp. 7526–7533 View at publisherCrossrefView at ScopusGoogle Scholar

M. Koike, M. Shibata, S. Waguri , K. Yoshimura, I. Tanida, E. Kominami And etc.

Involvement of autophagy in lysosome storage in neurons from mouse models of neuronal ceroid lipofuscinosis ( Batten disease ) Am J Pathol , 167 (2005), pp. 1713–1728 View PDF View Article View in ScopusGoogle Scholar

L. Qiao , S. Hamamichi , K. A. Caldwell, G. A. Caldwell, T. A. Yacoubian, S. Wilson and dr . Lysosomal enzyme cathepsin D protects against alpha-synuclein aggregation and toxicity Mol Brain, 1 (2008), p. 17 View in ScopusGoogle Scholar

V. Cullen, M. Lindfors , J. Ng, A. Paetau , E. Swinton, P. Kolodziej And etc. Cathepsin D expression level influences alpha-synuclein processing, aggregation and toxicity in vivo Mol Brain , 2 (2009), p. 5 View in ScopusGoogle Scholar

C. N. Suire , S. O. Abdul - Hay , T. Sahara , D. Kang , M. K. Brizuela , P. Saftig , et al. Cathepsin D regulates cerebral Abeta42 / 40 ratios through differential degradation of Abeta42 and Abeta40 in Alzheimer 's disease Res Ther , 12 (2020), p. 80 View in ScopusGoogle Scholar

C. N. Suire , M. A. Leissring Cathepsin D: A Potential Link Between Amyloid Beta Protein and Tauopathy in Alzheimer's Disease J Exp Neurol , 2 (2021), pp. 10-15 Google Scholar